Pr Jean-Michel Claverie, specialist in genomics, returns to the assertions of Pr Luc Montagnier concerning the “manufactured” character of the new coronavirus. It simply explains why it is impossible.
By Prof. Jean-Michel Claverie
In several recent interviews, Pr Luc Montagnier declared that SARS-CoV-2 would be a virus manipulated by the Chinese and which would contain DNA from HIV (the AIDS virus)! This claim would be based on the detection of similarities between the genome of SARS-CoV-2 and that of HIV.
Sequences of “bases” designated by letters
The “texts” of these genomes, written in a series of “bases”, designated by letters (A, T, G, C), for the two viruses, are publicly accessible in public databases such as that of the National Institute for Biotechnology Information in the USA.
These two genomes, 30,000 letters (or bases) long for SARS-CoV-2 and 9,200 letters (or bases) for HIV, code, among other things, for the proteins that allow viruses to multiply and manufacture the viral particles that allow their dissemination.
How to detect genetic manipulation?
Thanks to genetic engineering methods, it is indeed possible to modify the “texts” of all the genomes, either by modifying one letter at a time, or by inserting the equivalent of “paragraphs” (at least 300 letters) which would code for a protein.
To detect whether an insertion has taken place, it is a question of proceeding as one would do to detect plagiarism in a novel: we look if there are not, in places, similarities that are a little too obvious, for example an almost identical paragraph in both texts.
If this similarity concerns only a few words, or a sentence (for example a quotation), it will be considered that there has been no borrowing from one text in another. For plagiarism to be characterized, the extent of this resemblance must exceed the length commonly accepted for a coincidence between two texts written in the same language.
How to compare genomes?
The comparison of two genomes (to detect possible borrowing of genes from one to the other) is based on the same principle. As the genomes are written with the same letters ATGC, the detection of a sequence of similar letters is only a sign of a loan (a genetic manipulation) if this one is longer than what is expected from the restrained similarities that can be randomly linked in two completely independently written texts.
Universally accepted methods allow:
– to easily identify the areas of greatest resemblance between the genomes of Cov-2 and HIV
– to demonstrate that their levels of similarity do not exceed what is expected of chance, and therefore that they do not constitute proof of a borrowing (i.e. of an insertion or manipulation carried out by researchers).
Detection of similarities by statistical calculation.
The strongest similarity detected by comparing the 30,000 letters of CoV-2 with the 9,200 of HIV is a “sentence” of 38 letters, of which 33 are identical, at the cost of an insertion (“-“):
The second, less good (28/30) is as follows:
A (standard) calculation of the probabilities associated with this type of analysis tells us that areas reaching this level of similarity are expected more than three times randomly, that is to say by comparing sequences of the same lengths and of the same composition in A, T, G and C produced by a random draw.
Conclusion: these similarities are by no means unusual, and cannot serve as an argument in favor of genetic manipulation that would have inserted a piece of the HIV genome into that of SARS-CoV-2.
But another demonstration, which does not call for a statistical calculation, is even more convincing.
If we now take the piece of sequence of SARS-CoV-2 which would have been borrowed from HIV (according to Mr. Montagnier):
ATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTC
and if we look for it in the texts of the genomes of other much older strains of coronavirus (and naturally associated with bats), we can verify that it is indeed present:
Example for a virus isolated in 2005 (similarity 34/38):
This sequence area codes for the protein sequence “CANFNVLFSTVF” (the C, A, N …., letters symbolize different amino acids) conserved identically in all strains of coronavirus because it belongs to the enzyme which replicates the genome of the virus (RNA polymerase) and whose function is essential to it.
Conclusion, this area of resemblance to HIV is fortuitous, and existed in most strains of coronavirus long before the emergence of Covid-19.
Last point!
Finally, if we focus on the SARS-CoV-2 protein which is the most exposed on the surface of the virus (the famous “spike” protein), and which would therefore be the preferred target for making a vaccine (because it is the target of antibodies): its detailed comparison with the envelope protein of the HIV virus (the preferred target for making a vaccine against this virus), using universally accepted methods, does not detect any similarity.
.
